Bilimsel Araştırma Projeleri Bilgi Paylaşım Platformu

Atatürk Üniversitesi Satın Alma Duyurusu

64 Kalem Mal/Malzeme Alımı
17695
Prof.Dr. Zühal GÜVENALP
Eczacılık Fakültesi
Ersin Polat (118)
Doğrudan Temin
TDK-2020-8710
06 Ocak 2021
22 Ocak 2021
64 Kalem Mal/Malzeme Alımı
Sıra Harcama Türü Malzeme İsmi Miktar Birim Alım Kalemi Şartnamesi Genel Şartname
1 ssss albumin from bovine serum 10 g 1 Adet
2 ssss ANTIBIOTIC-ANTIMYCOTIC 100X 100 ML 1 Adet
3 ssss Apomorphine Hydrochloride 500 MG 1 Adet
4 ssss Asynuclein Antibody (3H2897) 1 Adet
5 ssss Balon, Armudi 100 ml Hacim , NS : 29/32 10 Adet
6 ssss Balon, Armudi 250 ml Hacim , NS : 29/32 10 Adet
7 ssss Balon, Armudi 500 ml Hacim , NS : 29/32 6 Adet
8 ssss BALON TEK BOYUNLU DY 25 ML NS 14.5/23 10 Adet
9 ssss Balon,Tek Boyunlu , DY 50 ml Hacim , NS : 14.5/23 10 Adet
10 ssss BİSTÜRİ SAPI (No:4) 2 Adet
11 ssss Butanol-1, RPE - For analysis - ISO, 2.5 l, Glass bottle 2 Adet
12 ssss B-27 10 ML 2 Adet
13 ssss CHLOROFORM 99%, BP 2,5 L 10 Adet
14 ssss DICHLOROMETHANE 99%, PH. EUR., NF 2,5 lt 10 Adet
15 ssss DMEM Ham’s F12 10 Adet
16 ssss ETHANOL ABSOLUTE ACS ISO 2,5 LT 6 Adet
17 ssss FBS SOUTH AMERİCA ORİGİN 500 ML 3 Adet
18 ssss FİLM YAPIŞTIRMA 100/ PK 1 Adet
19 ssss HYDROCHLORIC ACID FUMING 37% , PH EUR,BP,JP,NF 1 Adet
20 ssss IsHyb In Situ Hybridization (ISH) Kit for 50 slides (K2191050) 1 Adet
21 ssss Lowry Protein Assay Kit 1 Adet
22 ssss makas - laboratuar için - DÜZ / SİVRİ - 130 mm 2 Adet
23 ssss makas - laboratuar için - küt/sivri - 130 mm 2 Adet
24 ssss METHANOL EXTRA PURE 2,5 L 12 Adet
25 ssss METHANOL EXTRA PURE 2,5 L 6 Adet
26 ssss MİKROTOM BIÇAĞI FEATHER R35 50/ PK 1 Adet
27 ssss MTT Testi 2 Adet
28 ssss NEUROBASAL MEDIUM 500 ML 2 Adet
29 ssss N-HEXANE 98%, EXTRA PURE 2,5 LT 4 Adet
30 ssss Nitrotetrazolium Blue chloride (MA, 817.6) 100 MG 1 Adet
31 ssss pbs tablet 100 TAB 1 Adet
32 ssss pipet ucu - mavi - 1000 ul 500'LÜK 20 Adet
33 ssss PİPET UCU SARI 100 UL 1000/PK 15 Adet
34 ssss PİPET UCU ŞEFFAF NON STERİL 20 UL 1000/PK 6 Adet
35 ssss PİSET P.E DAR BOYUN 500 ML 10 Adet
36 ssss PLATE POLY-D-LYSIN 48 WELL BDBIOCOAT 1 Adet
37 ssss POLYAMIDE 6, FOR COLUMN CHROMATOGRAPHY 250 Gram 1 Adet
38 ssss poly-l-lysine (P8920) 100 ML 1 Adet
39 ssss potassıum chlorıde 1 KG 1 Adet
40 ssss Potassium phosphate monobasic 100G 1 Adet
41 ssss PRİMER 5Dig/ TTCAGAGGAAGGCTACCAAGAC (50nmol, HPLC-grade saflaştırma) 1 Set
42 ssss Proteinase K,(PC0712) 1g 1 Adet
43 ssss RAT KAFESİ 6 Adet
44 ssss Silica Gel 60 F254 25 Tlc Aluminium Sheets 20 X 20 Cm 10 Adet
45 ssss Silica gel 60 (0.063-0.200 mm) for column chromatography 1 Adet
46 ssss SODIUM CARBONATE ANHYDROUS 99.5%, PH EUR , BP , JP , NF 1 Adet
47 ssss SODIUM HYDROXIDE 99%, PELLETS PURE 1 KG 1 Adet
48 ssss Sodium phosphate dibasic dihydrate 1 KG 1 Adet
49 ssss Superoxide Dismutase from bovine erythrocytes 1 Adet
50 ssss Thiobarbituric acid 98% 100g 1 Adet
51 ssss tüp - mikrosantrfüj -P.P - 1,5 ml 500 adet / paket 1 Adet
52 ssss Tüp - santrfüj - P.P - vidalı kapaklı - 50 ml 50 adet / paket 1 Adet
53 ssss TÜP MİKROSANTRIFUJ P-P 2,0 ML 500/PK 1 Adet
54 ssss TÜP SANTRIFUJ PP VİDA KAPAKLI 15 ML 1 Adet
55 ssss Xanthine (MA,152.1) 10 g 1 Adet
56 ssss xanthine oxidase (167 U/L) 1 Adet
57 ssss 0.25% TRYPSIN-EDTA SOLUTION 100 ML 4 Adet
58 ssss 24 WELL PLATE POLY LYSINE D COATED 100/PK 1 Adet
59 ssss 5-5’-dithio-bis-(2-nitrobenzoic asit) 5 g 1 Adet
60 ssss 6-HYDROXYDOPAMİNE HYDROCHLORIDE 500 MG 1 Adet
61 ssss 96 well plate F (düz taban) kapaklı, ısıya dayanıklı 20 adet 1 Adet
62 ssss 96 well plate F (düz taban) 50 adet 1 Adet
63 ssss 96 WELL PLATE POLY LYSINE D COATED 100/PK 1 Adet
64 ssss tüp kutusu - karton - 50 ml tüpler için - geçme kapaklı 20 Adet